Linsheng Zhang's Learning & Education Webpage
import requests
# input of sequencing result
flt3_seq = 'CAATTTAGGTATGAAA......AAATGCTGAAAGGTACAGTA' # Your FLT3-ITD sequence from NGS result
url = 'https://flt3-itd-nomenclature.ue.r.appspot.com/nucleotideSequence/'+flt3_seq
r = requests.get(url)
nomenclature = r.json()
# the nomenclature you get is a dictionary:
{'aaDupIns': 'NGMCQMFLQHFPRENLEFGK', # full ins/dup aa sequence
'aaLength': 20, # itd aa length
'additionalInfo': [ # additional information (in a list)
"There is no insertion or variant(s) identified at the 3'-end of the ITD.",
'This FLT3-ITD involves the intronic region; ......'
],
'hgvsc': 'c.1816_1837+38dup', # nomenclature at cDNA level
'hgvsg': 'chr13:g.28608181_28608240dup', # nomenclature at chromosome level
'hgvsp': 'p.K614_V615ins20[NGMCQMFLQH;605_614]', # nomenclature at protein (aa) level
'nucleotideDupIns': 'CCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTC', # full ins/dup nucleotide sequence
'nucleotideLength': 60, # flt3-itd length (nucleotide)
'nucleotideSequence': 'CAATTTAGGTATGAAA......AAATGCTGAAAGGTACAGTA', # the original sequence submitted
'status': 'OK'} # result status: OK or Error message
curl 'https://flt3-itd-nomenclature.ue.r.appspot.com/nucleotideSequence/[your_flt3_seq]' -0 'file_name.json'
This Website is Built by: Linsheng Zhang, MD, PhD. Emory University Pathology. September 2022.